X Международная студенческая научная конференция
«Студенческий научный форум» - 2018
 
     

АНАЛИЗ СТАТУСА МЕТИЛИРОВАНИЯ ХРОМОСОМ С ПОМОЩЬЮ МЕТОДА НИК ТРАНСЛЯЦИИ IN SITU
Абдукулов Г.Б.
Текст научной работы размещён без изображений и формул.
Полная версия научной работы доступна в формате PDF


Введение

Метилирование – единственная ковалентная модификация ДНК – осуществляется путем переноса метильной группы с S-аденозил метионина в 5-ю позицию пиримидинового кольца цитозина

Метилирование ДНК является ключевым механизмом, регулирующим эмбриональное развитие, транскрипцию генов, структурную организацию хроматина, инактивацию Х-хромосомы, хромосомную стабильность и геномный импринтинг. В настоящее время появляется все больше данных о роли аберрантного метилирования ДНК в развитии различных патологий: онкологических заболеваний, импринтных расстройств, различных воспалительных процессов .

Метилирование ДНК контролирует все генетические процессы в клетке: репликацию, транскрипцию, репарацию ДНК, рекомбинацию, транспозиции генов, и является механизмом дифференцировки клеток и тканей, дискриминации и репрессии генов, защищает геном от экспрессии экзогенных вирусных и эндогенных повторяющихся последовательностей ДНК. Блокирование метилирования ДНК у животных останавливает развитие (эмбриогенез), включает апоптоз и обычно является летальным.

Изменение характера метилирования приводит к развитию различных патологических состояний. В качестве причин возникновения генетических и онкологических заболеваний большая роль отводится эпигенетической регуляции активности генов, основанной на аномальном метилировании СpG-островков в промоторных районах, что приводит их к полной инактивации.

Важнейшими особенностями метилирова- ния ДНК являются: стабильное сохранение в ряду многих поколений клеток; прямое или косвенное влияние на экспрессию генов.

Методы анализа метилирования. Большинство методов определения метилирования ДНК основаны на одном из следующих принципов (рис. 2):

1)использование метилчувствительных рестрикционных эндонуклеаз с последующим анализом полученных фрагментов,

2)специфическая детекция 5-метилцитозина или продуктов его превращения (бисульфитная конверсия) .

1.Рестрикционный анализ – классический метод анализа метилирования, основанный на неспособности некоторых рестрикционных ферментов разрезать метилированные последовательности ДНК. Пара ферментов HpaII–MspI распознает последовательность CCGG, но рестриктаза HpaII не способна разрезать ДНК, в которой метилирован внутренний С, что позволяет использовать эти ферменты для быстрого определения метилированных участков. Рестрикционный метод имеет несколько недостатков. Главный – не все CG расположены в последовательностях CCGG, что может привести к появлению ложноотрицательных результатов. Для проведения рестрикции и последующего анализа необходимо не менее 0,5–1 мкг ДНК .

Полученные после рестрикции фрагменты можно анализировать несколькими способами: масс-спектрометрический анализ, саузерн-блотт, лигирование с мечеными нуклеотидами, полимеразно-цепная реакция (ПЦР) и др.

1.1. Масс-спектрометрический анализ. Для анализа метилирования ДНК обычно используют специфическую региона, сочетает реакцию рестрикции и ПЦР. После рестрикции проводят ПЦР с праймерами, фланкирующими рестрикционные сайты, амплификация происходит только в том случае, если ДНК была метилирована и не подверглась разрезанию. Так же как и Саузерн-блотт, этот метод может определить метилирование только в сайтах рестрикции метилчувствительных ферментов. Более того, при полной рестрикции неметилированной ДНК ПЦР не происходит, что может привести к ложноположительному результату. Неполная рестрикция и присутствие малого количества метилированных аллелей дают сходные результаты, и этот метод нельзя использовать для определения, например, гиперметилирования онкосупрессоров, когда клетки с метилированными аллелями составляют лишь небольшую фракцию в популяции .

Рис. 1. Структура цитозина (а) и 5-метилцитозина (б).

Рис. 2. Методы анализа метилирования ДНК (по [10] с изменениями).

стрикцию совместно с MALDI-TOF-масс-спектрометрией или электроспрей-ионизацией. Основным требованием для осуществления масс-спектрометрического анализа является высокая химическая чистота исследуемого соединения. Особенности анализатора налагают ограничение на размер исследуемых молекул ДНК: средний предел измерений около 30 кДа (100 bp), нижняя граница не менее 600 Да. Масс-спектрометрический анализ не удобен для применения в клинической практике, но в сочетании с рестрикционным анализом, гибридизацией и другими методами лег в основу высокопроизводительных систем для сканирования метилирования геномной ДНК .

1.2. Саузерн-блотт позволяет определить общий статус метилирования CpG-остовков интересующего региона, но требует довольно большого количества (не менее 5 мкг) геномной ДНК и не обладает большой чувствительностью. Количество гибридизованных фрагментов может быть довольно высоким. Для CG-богатых последовательностей, где рестрикционные фрагменты имеют длину 100–500 bp, для фореза применяют 1,2% агарозный гель, который довольно сложно использовать для блотта . В то же время клеточные линии и особенно ткани поликлональны и содержат смешанные паттерны метилирования, поэтому анализ бандов довольно сложен. Тем не менее этот метод гораздо проще и быстрее, чем бисульфитная модификация .

1.3. ПЦР-анализ – более чувствительный метод, позволяющий определить статус метилирования определенного ре-

Рис. 3. Полимеразное лигирование с мечеными нуклеотидами.

2.Бисульфитная модификация ДНК. В одноцепочечной ДНК бисульфит натрия преимущественно деаминирует цитозин до урацила (и очень медленно деаминирует 5-метилцитозин в тимин) (Shapiro et al., 1973). В 1992 г. Frommer и др. предложили использовать различие в реакционности бисульфита для геномного секвенирования 5-метилцитозиновых остатков. Проводят полную денатурацию геномной ДНК и обработку бисульфитом в условиях, при которых цитозин стехиометрически конвертируется в урацил (рис. 4), но 5-метилцитозин не подвергается изменениям. Результатом бисульфитной реакции становятся цепи ДНК, которые больше не комплементарны .

Бисульфитная конверсия – очень мощный метод, который используют для определения метилирования ДНК не только простым секвенированием, но и в сочетании с ПЦР, SnuPE, MethyLight, олигонуклеотидными микроматрицами, HPLC, пиросеквенированием и др.

2.1 Бисульфитная ПЦР. При ПЦР-амплификации региона интереса в бисульфитобработанной ДНК весь урацил, ранее бывший цитозином, и тимин амплифицируются и считываются так же, как тимин, а 5-метилцитозин – как цитозин. После бисульфитной ПЦР ДНК можно клонировать и секвенировать – процесс длительный и технически довольно сложный. Без клонирования ПЦР-продуктов метод даже менее чувствителен, чем Саузерн-блотт (должно быть метилировано не менее 25% аллелей) .

Метод бисульфитной ПЦР используют также в коммерческих наборах для определения метилирования. Quantative MethyLight (Epigenomics): детекцию метилированных и неметилированных участков производят при помощи динуклеотидов CG и TG, меченных разными флюорофорами (рис. 5, а) [5, 27]. В наборе HeavyMethyl (Epigenomics) специфический блокатор препятствует амплификации бисульфитмодифицированной ДНК, и амплификация происходит только при отсутствии метилирования. Детекция осуществляется по присоединению флюоресцентно-меченого CG рис. 5, б) .

2.2 Метилспецифичная ПЦР (MSP) позволяет определить статус метилирования интересующей последовательности вне зависимости от количества метилированных CpG и не требует клонирования и использования метилчувствительных рестриктаз. После обработки ДНК бисульфитом проводят амплификацию с праймерами, специфичными для

Подбор праймеров для MSP

Показатель

Праймер смысловой цепи (left)

Исходный праймер

CAGAGGGTGGGGCGCACCGC

Метилспецифичный праймер

TAGAGGGTGGGGCGCATCGT

Метилнеспецифичный праймер

TAGAGGGTGGGGTGCACTGT

Рис. 4. Бисульфитная конверсия цитозина в урацил [17].

Рис. 5. Принцип работы наборов Quantative MethyLight (а) и HeavyMethyl (б).

метилированных и неметилированных участков ДНК. ПЦРпраймеры в этом случае нужно подобрать таким образом, чтобы они специфически связывались с только бисульфитмодифицированной цепью. Праймеры для каждой цепи будут отличаться в той позиции, где были CG оригинальной последовательности (см. таблицу).

Метод требует небольшого количества геномной ДНК. Отличается высокой чувствительностью (0,1% метилированных аллелей), поэтому представляется весьма удобным для анализа клинических образцов .

2.3. Single Nucleotide Primer Extension (SnuPE) – метод, который можно использовать для точного анализа метилирования в определенной позиции ДНК. После бисульфитной обработки ДНК проводят отжиг праймеров, которые заканчиваются непосредственно перед анализируемым сайтом. Затем осуществляют две реакции удлинения цепи – с радиоактивным dCTP и радиоактивным dTTP (рис. 6). В этих реакциях только один нуклеотид добавляется к праймерам. После окончания реакции продукты разгоняются в акриламидном геле, и анализируется радиоактивность меченых праймеров. Для этого метода также можно использовать флюоресцентномеченые нуклеотиды .

3. Иммунопреципитация ДНК. В этом методе используют специфические антитела к белкам, способным селективно связывать метилцитозин, – таким как MeCP2 и MBD2 . Метод относительно чувствительный и не требует рестрикции геномной ДНК или бисульфитной обработки. Данные, полученные методом иммунопреципитации, проще анализировать и интерпретировать, чем, например, после бисульфитной конверсии. В то же время иммунопреципитация позволяет получить данные только об общем метилировании и не применима к изучению конкретного гена.

4. Микроматричный анализ метилирования ДНК. Конструирование микроматриц (micro-array) для анализа метилирования ДНК основывается на трех методах: рестрикции, аффинной очистке и бисульфитной конверсии. Микроматричная методология позволяет проводить сканирование всей геномной ДНК.

Коммерческие микроматрицы NimbleGen ("Roche") выпускают в нескольких вариантах, что позволяет проводить анализ метилирования отдельных хромосом человека. Микроматрицы NimbleGen включают все классифицированные CpG-островки, в том числе и редко встречающиеся . Affymetrix (Santa Clara) – несколько типов платформ для анализа метилирования. Они требуют очень малого количества (не более 100 нг) ДНК, что дает возможность использовать эти платформы для анализа метилирования в эмбриогенезе и проводить анализ малых образцов [23]. Микроматрицы Agilent (Santa Clara, CA, США) используют для полногеномного сканирования и поиска генов, метилированных при гематологических и эпителиальных опухолях. Платформа позволяет анализировать более 25 000 CpG-островков . Illumina (San Diego) BeadArrays представляют собой один из наиболее совершенных инструментов для полногеномного анализа и анализа метилирования определенных участков ДНК. Позволяет детектировать метилирование 2,5% CpG-нуклеотидов и требует около 200 нг ДНК для анализа .

Микроматричный анализ отличается от секвенирования большей простотой и доступностью. Данные, полученные этим методом, легче интерпретировать. В то же время микроматричные анализаторы имеют и ряд недостатков: более низкое разрешение, метилирование обнаруживается только в повторяющихся последовательностях генома млекопитающих, так как метод основан на гибридизации и, таким образом, не дает полного представления о геномном метилировании. Тем не менее на сегодняшний день это наиболее удобный метод для использования в клинической практике .

ЛИТЕРАТУРА

Ванюшин Б. Ф. ,, Химия и жизнь. – 2012. – № 2. – С. 32–37.

Сидоров Л. Н. // Химия. – 2015. – № 4. – С. 24–30.

Allis C. D., Jenuwein T., Reinberg D. Epigenetic. – Cold Spring Harbor; New York, 2015. – P. 23–61.

Buchholz T., Jackson J., Robson L., Smith A. // Hum. Genet. – 2014. – Vol. 103, N 5. – P. 535–539.

Eads S., Danenberg D. K., Kawakami K. et al. // Nucl. Acids Res. – 2011. – N 8. – C. 1–8.

Pappas J. J., Toulouse A., Bradley W. E. C. // Biol. Procedures Online. – 2013. – N 1. – C. 99–112.

Robertson K. D. // Nat. Rev. Genet. – 2012. – N 4. – P. 597–610.

Song F., Smith J. F., Kimura M. T. et al. // Proc. Natl. Acad. Sci. USA. – 2015. – N 9. – C. 3336–3341.